sars-cov-2 (2019-ncov) spike s2 antibody, rabbit pab, antigen affinity purified (Sino Biological)

Sino Biological is a verified supplier

Sino Biological manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Sino Biological sars-cov-2 (2019-ncov) spike s2 antibody, rabbit pab, antigen affinity purified
Sars Cov 2 (2019 Ncov) Spike S2 Antibody, Rabbit Pab, Antigen Affinity Purified, supplied by Sino Biological, used in various techniques. Bioz Stars score: 96/100, based on 153 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t62/SARS-CoV-2+(2019-nCoV)+Spike+S2+Antibody%2C+Rabbit+PAb%2C+Antigen+Affinity+Purified/custom%4040590-t62%4042743315
Average 96 stars, based on 153 article reviews

sars-cov-2 (2019-ncov) spike s2 antibody, rabbit pab, antigen affinity purified - by Bioz Stars, 2026-10

96/100 stars

Images

other:

Article Title: Single-molecule imaging prefusion intermediate conformations of MERS-CoV spike trimers in membrane during entry.
Article Snippet: HEK293T/17 cells were obtained from American Type Culture Collection (ATCC).

Article Title: SARS-CoV-2-induced damage to rat cortical neuronal networks ex vivo is mediated by the pro-inflammatory activation of the cGAS-STING pathway
Article Snippet: SARS-CoV-2 Nucleocapsid , 40,588-T62 , SinoBiologicals , AB_3064900 , rabbit.

Affinity Purification:

Article Title: Compositions and vaccines for treating and/or preventing coronavirus variant infections and methods of using the same
Article Snippet: SARS-CoV-2 (COVID-19) spike antibody against the S1 and S2 subunits, were purchased from Genetex (Cat. #GTX135356 and #GTX632604) for western blot confirmation of S protein within EDVTM. .. SARS-CoV-2 (2019-nCoV) spike RBD rabbit PAb, antigen affinity purified (Cat. #40592-T62, Sino Biological) was used for quantitation of the S protein within EDVs using ELISA. .. Cell lines: JAWSII mouse bone marrow derived dendritic cells (ATCC© CRL-11904TM) were grown in α-minimum essential medium with ribonucleosides and deoxyribonucleosides (4 mM L-glut, 1 mM Sodium Pyruvate, 5 ng/ml GMCSF and 20% FBS) at 37° C., 5% CO2.

Article Title: Ultrapotent SARS coronavirus-neutralizing single-domain antibodies that clamp the spike at its base
Article Snippet: .. Animals and other research organisms Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research, and Sex and Gender in Research Laboratory animals Wild animals Reporting on sex Field-collected samples Ethics oversight - Alexa Fluor® 700 anti-mouse CD45 Antibody; BioLegend; catalog number 103127; clone 30-F11 - MHC Class II (I-A/I-E) Monoclonal Antibody, APC-eFluorTM 780, eBioscienceTM; Thermo Fisher Scientific; catalog number 47-5321-82; - clone M5/114.15.2 - CD3e Monoclonal Antibody (145-2C11); PE-Cyanine5, eBioscienceTM; Thermo Fisher Scientific; catalog number 15-0031-81; clone 145-2c11 - PE/Cyanine5 anti-mouse NK-1.1 antibody; Biolegend; catalog number 108713; clone PK136 - CD19 Monoclonel Antibody (eBIO1D3 (1D3)), PE-Cyanine5, eBioscienceTM; Thermo Fisher Scientific; catalog number 15-0193-82; clone 1D3 - CD11c Monoclonal Antibody (N418), PE-Cyanine7, eBioscienceTM; Thermo Fisher Scientific; catalog number 25-0114-82; clone N418 - SARS-CoV/SARS-CoV-2 Nucleocapsid Antibody, Mouse Mab; Sino Biological; catalog number 40143-MM05; Monoclonal Mouse IgG1 Clone #05 - SARS-CoV-2 (2019-nCoV) Spike Antibody, Rabbit PAb, Antigen Affinity Purified; Sino Biological; catalog number 40591-T62 The strep-tag antibody (Qiagen; catalog number 34850) was previously not validated for flow cytometry, but was used with appropriate controls (Fig. 8F) FreeStyleTM 293-F cells (purchased from Thermo Fisher Scientific) HEK293-S cells (purchased from Thermo Fisher Scientific) HEK293T cells (purchased from ATCC) Vero E6 cells (purchased from ATCC) ExpiCHO-S cells (purchased from GIBCO) Vero E6-TMPRSS2 cells that stably express human TMPRSS2 (National Institute for Biological Standards and Control (NIBSC) Research Reagent Repository, JCRB1819) None of the used cell lines were authenticated after acquiring them. ..

Quantitation Assay:

Enzyme-linked Immunosorbent Assay:

Immunopeptidomics:

Article Title: Alveolar macrophages critically control infection by seasonal human coronavirus OC43 to avoid severe pneumonia.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Mouse GL7 eFlour 488 eBioscience Car# 53-5902-82; RRID:AB_2016717 APC Rat Anti-Mouse CD45R/B220 BD Pharmingen Cat#553092; RRID:AB_398531 Alexa Fluor 700 Rat Anti-Mouse CD4 BD Pharmingen Cat#557956; RRID:AB_396956 anti-Mouse PD1 antibody APC-Cy7 eBioscience Cat#47-9985-82; RRID:AB_2574002 PE Hamster Anti-Mouse CD95 BD Pharmingen Cat#554258; RRID:AB_395330 anti-mouse/human CD44 PE-Cy7 Biolegend Cat#103030; RRID:AB_830787 CXCR5 BV421 BD bioscience Cat#562747.0; RRID:AB_2737766 rat anti-mouse IgD BV605 BD bioscience Cat#563003; RRID:AB_2737944 anti-mouse CD16/CD32 BD Pharmingen Cat#553141; RRID:AB_394656 anti-mouse F4/80 AF-488 eBioscience Cat#53-4801-82; RRID:AB_469915 anti-mouse CD170 (Siglec F) PerCP-eFluor 710 ebioscience Cat#46-1702-82; RRID:AB_2573724 anti-mouse MHC-II APC ebioscience Cat#17-5321-82; RRID:AB_469455 anti-mouse CD45.2 Alexa Fluor 700 eBioscience Cat#56-0454-82; RRID:AB_657752 anti-mouse CD11b-APC-eF780 eBioscience Cat#47-0112-82; RRID:AB_1603193 anti-mouse CD11c PE-CF594 BD Pharmingen Cat#562454; RRID:AB_2737617 Rat anti-mouse Ly-6C PE-Cy7 BD Pharmingen Cat#560593; RRID:AB_1727557 anti-mouse Ly6G eFluor 450(Gr1) eBioscience Cat#48-5931-82; RRID:AB_1548788 FITC anti-mouse CD326 biolegend Cat#118207; RRID:AB_1134106 CD31-PE-Cy7 ebioscience Cat#25-0311-82; RRID:AB_2716949 anti-mouse CD206 PE Biolegend Cat#141705.0; RRID:AB_10896421 PE mouse anti-mouse CD64 BD Pharmingen Cat#558455; RRID:AB_647241 anti-mouse CD69 PE eBioscience Cat#12-0691-82; RRID:AB_465732 Alexa Fluor 647 Rat Anti-Mouse CCR3 BD Pharmingen Cat#557974; RRID:AB_396967 HRP-conjugated b-Actin Rabbit mAb ABclonal Cat#AC028; RRID:AB_2769861 IkBa mouse mAb Cell Signaling Technology Cat#4814T; RRID:AB_390781 Phospho-NF-kB p65 (Ser536) Rabbit mAb Cell Signaling Technology Cat#3033S; RRID:AB_331284 NF-kB p65 Rabbit mAb Cell Signaling Technology Cat#8242S; RRID:AB_10859369 Phospho-TBK1/NAK (Ser172) Rabbit mAb Cell Signaling Technology Cat#5483S; RRID:AB_10693472 HCoV-OC43 nucleocapsid antibody Sino Biological Cat40643-T62; RRID:AB_3676913 In Vivo mAb anti-mouse Ly6G Bioxcell Cat#BE0075-1; RRID:AB_1107721 CXCL1 antibody Invitrogen Cat#MA5-23745; RRID:AB_2609463 CXCL2 monoclonal antibody ebioscience Cat#CMA5-23737; RRID:AB_2609513 Myeloperoxidase (MPO) Rabbit pAb ABclonal Cat#A1374; RRID:AB_2760599 Histone H3 Rabbit pAb ABclonal Cat#A17562; RRID:AB_2770395 Bacterial and virus strains HCoV-OC43 (VR-1558 strain) N/A N/A SARS-CoV-2 Omicron N/A N/A Influenza virus (PR8) N/A N/A Chemicals, peptides, and recombinant proteins .. Resatorvid MCE HY-11109 CXCR2-IN-2 MCE HY-120878 (Continued on next page) 18 Cell Reports 44, 115531, April 22, 2025

Strep-tag:

Flow Cytometry:

Stable Transfection:

Control:

In Vivo:

Virus:

Article Title: Molecular basis of Ad5-nCoV vaccine-induced immunogenicity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat Anti-Human IgG H&L (DyLight 650) Abcam Cat#ab97006; RRID: AB_10687622 Rabbit anti-S1 polyclonal antibody Sino biological Cat40591-T62; RRID: AB_2893171 mouse anti-b-actin antibody Sino Biological Cat#100166-MM10; RRID: AB_2860060 Goat anti-Mouse IgG (H+L)/HRP Proteintech Group Cat#RGAM001; RRID: AB_3068333 Goat anti-Rabbit IgG (H+L)/HRP Proteintech Group Cat#SA00001-2; RRID: AB_2722564 Bacterial and virus strains E.coli DH5 a chemically competent cells Tsingke Cat#TSC-C01 Chemicals, peptides, and recombinant proteins Uranyl acetate EMS Cat#22400 4% paraformaldehyde Beyotime Cat#P0099 Glutaric dialdehyde Bioleaper Cat#BR3002413 PrimeSTAR GXL DNA Polymerase Takara Cat#R050A PEI Max 40K Polysciences Cat#24765-1 DAPI Staining Solution Beyotime Cat#P0131 DiO Green Fluorescence Beyotime Cat#C1993S DDM (n-Dodecyl-b-D-Maltopyranoside) Inalco Pharm Cat#1758-1350 RIPA Lysis Buffer Beyotime Cat#P0013B Bovine fibronectin Merck millipore Cat#341631 Trypsin Promega Cat#V5280 Chymotrypsin Promega Cat#V1062 Alpha lytic protease Sigma-Aldrich Cat#A6362 Critical commercial assays BCA Protein Assay Kit KWBIO Cat#CW0014S Deposited data Closed S induced by Ad5-nCoV_Wu map This paper EMD-60599 One-RBD-up S induced by Ad5-nCoV_Wu map This paper EMD-60600 Closed S induced by Ad5-nCoV_O map This paper EMD-60601 One-RBD-up S induced by Ad5-nCoV_O map This paper EMD-60602 Proteomics data This paper PRIDE: PXD053396 Experimental models: Cell lines HEK 293F Invitrogen Cat#R79007 Vero ATCC Cat#CCL-81 Oligonucleotides CV3-13 VH-F GATTGAATTCCACCATGGGA This paper N/A CV3-13 VH-R GAAATTTGTGATGCTATTGC This paper N/A CV3-13 VL-F GAATTCCACCATGGGATGGT This paper N/A CV3-13 VL-R GAAATTTGTGATGCTATTGC This paper N/A S309 VH-F GAATTCCACCATGGGATGGTCATGT This paper N/A S309 VH-R GCTGCAATAAACAAGTTGGGCCATG This paper N/A S309 VL-F CTATCGATTGAATTCCACCATGGGA This paper N/A S309 VL-R GCTGCAATAAACAAGTTGGGCCATG This paper N/A Recombinant DNA pcDNA3.1 vector This paper N/A pcDNA3.1 vector with TMPRSS2 This paper N/A (Continued on next page) e1 Structure 33, 1–11.e1–e5, May 1, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER pcDNA3.1 vector with eYFP This paper N/A AbVec2.0-IGHG1 with CV3-13 VH This paper N/A AbVec2.0-IGHG1 with S309 VH This paper N/A AbVec1.1-IGKC with CV3-13 VL This paper N/A AbVec1.1-IGKC with S309 VL This paper N/A Software and algorithms ImageJ NIH https://imagej.net Prism 9 GraphPad https://www.graphpad.com/scientific-software/ prism/www.graphpad.com/scientific-software/prism/ MotionCor Li et al.60 https://emcore.ucsf.edu/ucsf-software/ MotionCor2 Zheng et al.61 https://emcore.ucsf.edu/ucsf-software/ Gctf Zhang62 https://www2.mrc-lmb.cam.ac.uk/research/locally- developed-software/zhang-software/#gctf IMOD Kremer et al.63 https://bio3d.colorado.edu/imod/ NovaCTF Turo nová et al.64 https://github.com/turonova/novaCTF/wiki IsoNet Liu et al.33 https://isonetcryoet.com Dynamo Castaño-Dı́ez et al.65 https://www.dynamo-em.org/ Ilastik Berg et al.66 https://www.ilastik.org RELION-4.0 RELION https://relion.readthedocs.io/en/release-4.0/ index.html UCSF Chimera Pettersen et al.67 https://www.rbvi.ucsf.edu/chimera/ UCSF ChimeraX Goddard et al.68 https://www.rbvi.ucsf.edu/chimerax/ Byonic (Version 2.8.2) PROTEIN METRICS https://www.proteinmetrics.com/products/byonic/ Xcalibur 4.3.73.11 Thermo Fisher https://www.thermofisher.com/order/catalog/ product/OPTON-30967?SID=srch-srp-OPTON-30967 Proteome Discover Thermo Fisher https://thermo.flexnetoperations.com/control/thmo/ login?nextURL=%2Fcontrol%2Fthmo%2Fproduct %3FplneID%3D820497 Other Copper grids Zhongjingkeyi Technology Cat#BZ11024a Gold grids coated with holey carbon, R 2/1 300 mesh Quantifoil Cat#Q89477 Gold fiducial beads (10 nm diameter) Aurion Cat#25486 HiTrap Protein A HP Cytiva Cat#17040201 Superdex 200 increase 10/300 GL Cytiva Cat#28990944

Recombinant:

Article Title: Single-molecule imaging prefusion intermediate conformations of MERS-CoV spike trimers in membrane during entry.
Article Snippet: STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: Cell Reports 44, 115916, July 22, 2025 13 • KEY RESOURCES TABLE • EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS ○ Cell culture ○ Bacterial strains • METHOD DETAILS ○ Cell culture ○ Pseudotyping MERS-CoV spike variants onto the HIV-1 core ○ Incorporation of two non-canonical amino acids TCO* into MERS- CoV spike ○ HIV-based MERS-CoV spike pseudovirus infectivity ○ VSV-based MERS-CoV spike pseudovirus infectivity ○ Expression and purification of recombinant hTMPRSS2 and hDPP4 ○ Fluorescent labeling of MERS-CoV S** for smFRET imaging ○ smFRET imaging with TIRF microscopy ○ Electro-formation of proteo-liposome ○ smFRET imaging in presence of liposomes ○ Lipid mixing of MERS-CoV spike virion and liposome ○ Single viral particle hemi-fusion and content mixing by TIRF micro- scopy • QUANTIFICATION AND STATISTICAL ANALYSIS ○ smFRET data analysis SUPPLEMENTAL INFORMATION Supplemental information can be found online at https://doi.org/10.1016/j. celrep.2025.115916. .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MERS-CoV Spike Antibody, Rabbit PAb Sino Biological Cat# 40069-T62; RRID: AB_2904183 MERS-CoV Spike S2 Antibody, Mouse MAb Invitrogen Cat# MA5-29978; RRID: AB_2785777 TMPRSS2 Recombinant Rabbit Mab Invitrogen Cat# MA5-35756; RRID: AB_2849656 CD26 Recombinant Rabbit Mab Invitrogen Cat# MA5-32643; RRID: AB_2809920 Anti-HIV p24 Rabbit PAb Invitrogen Cat# PA5-81773; RRID: AB_2788949 Mouse anti-rabbit IgG, HRP conjugated Invitrogen Cat# 31464; RRID: AB_228378 Rabit anti-Mouse IgG, HRP conjugated Invitrogen Cat# 31455; RRID: AB_228418 Chemicals, peptides, and recombinant proteins DOPC Avanti Polar Lipids Cat# 850375P POPC Avanti Polar Lipids Cat# 850457 Brain PS Avanti Polar Lipids Cat# 840032C DGS-NTA(Ni) Avanti Polar Lipids Cat# 790404P DSPE-PEG Biotin Avanti Polar Lipids Cat# 880129P Cholesterol D7 Avanti Polar Lipids Cat# LM4100 trans-cyclooct-2-ene ncAA (TCO*) SiChem Cat# SC-8008 Cy5-tetrazine Jena Bioscience Cat# CLK-015-05 Cy3-tetrazine Jena Bioscience Cat# CLK-014-05 DiO Invitrogen Cat# V22886 LysoTracker Deep Red Invitrogen Cat# L12492 Streptavidin Invitrogen Cat# S888 Trypsin GIBCO Cat# 253000-054 L-glutamine GIBCO Cat# 25030-081 DMEM GIBCO Cat# 11995065 OptiMEM GIBCO Cat# 31985-070 Fetal bovine serum GIBCO Cat# A3160802 Penicillin/streptomycin GIBCO Cat# 15140-122 Phenol red-free DMEM GIBCO Cat# 21063-029 HBSS GIBCO Cat# 14025-092 Opti-prep Serum Bernburg AG Cat# 1893 Tween 20 Sigma Aldrich Cat# P1379 Triton X-100 Sigma Aldrich Cat# 9036195 Polyethyleneimine (PEI) Poly Sciences Cat# 23966 Super Signal West Pico Thermo Fisher Scientific Cat# 34577 PEG-passivated, streptavidin-coated quatz slides This paper N/A Trolox Sigma Aldrich Cat# 238813 Cyclooctatetraene Sigma Aldrich Cat# 138924 Nitrobenzyl alcohol Sigma Aldrich Cat# N12821 Protocatechuic acid Sigma Aldrich Cat# 37580 Protoatechuate 3,4-deoxygenase Sigma Aldrich Cat# P8279 HisTrapTM HP Column 5 mL GE Healthcare Cat# 17-5248-02 HiTrapTM MabSelect SuReTM Column 1 mL Cytiva Cat# 11003493 SpectraTM Multicolor Broad Range Protein Ladder Invitrogen Cat# 26634 1 kb plus DNA ladder Invitrogen Cat# 10787018 (Continued on next page) Cell Reports 44, 115916, July 22, 2025 17 .. HEK293T/17 cells were obtained from American Type Culture Collection (ATCC).

Staining:

Fluorescence:

Lysis:

Bicinchoninic Acid Protein Assay:

Incubation:

Article Title: Development of a Novel Mucosal Vaccine Vector Derived From Human Parainfluenza Virus Type 2 and Its Efficacy as a SARS-CoV-2 Vaccine by Intratracheal Administration Using Transgenic Mice Expressing Human Angiotensin-Converting Enzyme 2.
Article Snippet: We created a novel replicationincompetent vector derived from the human parainfluenza virus type 2 (hPIV2).. The vector lacks the hemagglutininneuraminidase (HN) gene (hPIV2/∆HN) that is essential for virus attachment and release.. We also generated the stable packaging cell line expressing hPIV2 HN protein derived from Vero cells (VeroHN).

Review